View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17782_low_7 (Length: 315)
Name: NF17782_low_7
Description: NF17782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17782_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 302
Target Start/End: Original strand, 43502528 - 43502810
Alignment:
| Q |
18 |
acacgtgtcattttcccatgcaacgcaagtatttgttttctgttaacccttcgatttttagnnnnnnngattctatcaatcggttactcgtctaaaagat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |||| |
|
|
| T |
43502528 |
acacgtgtcattttcccatgcaacgcaagtatttgttttctgttaacccttcgatttttagaaaaaaagattctatcaatcgattactcgtctaagagat |
43502627 |
T |
 |
| Q |
118 |
aaataacttatgataaagaagtatttcagctacatattaagctcagaatctcttaaataatttttcgttaaatgaaactaattaaaccnnnnnnnnagag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
43502628 |
aaataacttatgataaagaagtatttcagctacatattaagctcagaatctcttaaatgatttgtcgttaaatgaaactaattaaacc--ttttttagag |
43502725 |
T |
 |
| Q |
218 |
ggtaactaaataaacatttgaacaccattacttggttaatgtaagtctttttcatttgtacgattacgattattattactatgtt |
302 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43502726 |
ggaaactaaataaacatttgaacaccattacttggttaatgtaagtctttttcatttgtacgattacgattattattactatgtt |
43502810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University