View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17783_high_5 (Length: 363)
Name: NF17783_high_5
Description: NF17783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17783_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 16 - 357
Target Start/End: Complemental strand, 48980179 - 48979837
Alignment:
| Q |
16 |
atacccttgccctagttaaacaagagagtttctttctccacacaaatatagtttattcattgtttggtaacaacgttaaaccgcttctataac-caattc |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
48980179 |
atacccttgccctagttaaacaagatagtttctttctccacacaaatatagtttattcattgttttgtaacaacgttaaaccgcttctataacgcaattc |
48980080 |
T |
|
| Q |
115 |
tcataacttcttggaatggacagtggtgtgattatggagggaaggaaggaggatcgaaggggctcacttcagtccagtccaagacggtagaagatggctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48980079 |
tcataacttcttggaatggacagtggtgtgattatggagggaaggaaggaggatcgaaggggctcacttcagtccagtccaagacggtagaagatggctg |
48979980 |
T |
|
| Q |
215 |
agactcagctgctgactcgttggttcaatagctcacaacatgcatagtgtcaacgtgtgtgcttctgatccaacgatgcgggagctgcattccagtcgtc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48979979 |
agactcagctgctgactcgttggttcaatagctcacaacatgcatagtgtcaacgtgtgtgcttctgatccaacgatgcgggagctgcattccagtcgtc |
48979880 |
T |
|
| Q |
315 |
actgtcatgtcttggactgaaggggcctcttcatcgcctccag |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48979879 |
actgtcatgtcttggactgaaggggcctcttcatcgcctccag |
48979837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University