View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17784_high_12 (Length: 251)
Name: NF17784_high_12
Description: NF17784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17784_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 14367765 - 14367848
Alignment:
| Q |
1 |
tgtttgctaaagttaatttaagcataagtcggcagaaagatagttcacttttattattcagtaattaaaagaggtcaaatatca |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14367765 |
tgtttgctaaagttaatttaagcataagtcggcagaaagatagttcacttttattattcagtaattaaaagaggtcaaatatca |
14367848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 14367952 - 14367998
Alignment:
| Q |
188 |
gttggtaaattaatatctctctgtcccactatagtagtacaacaatt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14367952 |
gttggtaaattaatatctctctgtcccactatagtagtacaacaatt |
14367998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University