View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17784_high_15 (Length: 239)
Name: NF17784_high_15
Description: NF17784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17784_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 16 - 123
Target Start/End: Original strand, 35011214 - 35011311
Alignment:
| Q |
16 |
ttcttaattgagattttctcttcaaagatttgtctaagtttgttcatgtaatttagacgaattctgctttgctcttagcagaggaattgctatttgatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35011214 |
ttcttaattgagattttctcttcaaagatttg----------ttcatgtaatttagacgaattctgctttgctcttagcagaggaattgctatttgatca |
35011303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 35011359 - 35011408
Alignment:
| Q |
171 |
gggtagaatgaatttcaaagaccagcaactacttctattcccatcgaaat |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35011359 |
gggtataatgaatttcaaagaccagcaactacttctattcccatcgaaat |
35011408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University