View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17784_high_15 (Length: 239)

Name: NF17784_high_15
Description: NF17784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17784_high_15
NF17784_high_15
[»] chr4 (2 HSPs)
chr4 (16-123)||(35011214-35011311)
chr4 (171-220)||(35011359-35011408)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 16 - 123
Target Start/End: Original strand, 35011214 - 35011311
Alignment:
16 ttcttaattgagattttctcttcaaagatttgtctaagtttgttcatgtaatttagacgaattctgctttgctcttagcagaggaattgctatttgatca 115  Q
    ||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35011214 ttcttaattgagattttctcttcaaagatttg----------ttcatgtaatttagacgaattctgctttgctcttagcagaggaattgctatttgatca 35011303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 35011359 - 35011408
Alignment:
171 gggtagaatgaatttcaaagaccagcaactacttctattcccatcgaaat 220  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||    
35011359 gggtataatgaatttcaaagaccagcaactacttctattcccatcgaaat 35011408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University