View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17784_high_7 (Length: 315)
Name: NF17784_high_7
Description: NF17784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17784_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 37733881 - 37733616
Alignment:
| Q |
1 |
gcataagctagcctggtctgactcacagaaagttctagctggaagcttgcagagttcgcagtttttcttcatgatcagagtcttctgattttcctttctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37733881 |
gcataagctagcctggtctgactcacagaaagttctagctggaagcttgcagagttcgcagtttttcttcatgatcagagtcttctgattttcctttctc |
37733782 |
T |
 |
| Q |
101 |
tcaacgcggtttcgttcttcgttgatttgtgaatattgtttttgcggaattttcgttgttttggg--tctctctctcttttcttgtgatggtttggtatg |
198 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
37733781 |
tcaacgcggtttcgttcttctttgatttgtgaatattgtttttgcggaattttcgttgtttttggtttctctctctcttttcttgtgatggtttggtatg |
37733682 |
T |
 |
| Q |
199 |
gatgaagaatgggtaagaagaggaaagtagatacctcttcctgatatttataagcaaaaagtatat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37733681 |
gatgaagaatgggtaagaagaggaaagtagatgcctcttcctgatatttataagcaaaaagtatat |
37733616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University