View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17784_high_8 (Length: 280)
Name: NF17784_high_8
Description: NF17784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17784_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 45 - 273
Target Start/End: Original strand, 19768979 - 19769210
Alignment:
| Q |
45 |
acagctacttcagagttgagaaattttcagcggcacacttgagttttcagtttcaccaatcaccgcacataaactacgctgggaattatctat---ctat |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19768979 |
acagctacttcagagttgagaaattttcagcggcacacttgagttttcagtttcaccaatcaccgcacataaactacgctgggaattatctattatctat |
19769078 |
T |
|
| Q |
142 |
agattgacactaggcagagaaatgatatatatacattgttcctgctagcagctcttctttgtctatcagaatttgaaggtcttaagtttaaaatatcata |
241 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19769079 |
agattgacactacgcaaagaaatgatatatatacattgttcctgctagcagctcttctttgtctataagaatttgaaggtcttaagtttaaaatatcata |
19769178 |
T |
|
| Q |
242 |
tatgcaaactttagaaccgtttttctctgctc |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19769179 |
tatgcaaactttagaaccgtttttctctgctc |
19769210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 47 - 145
Target Start/End: Original strand, 28138986 - 28139085
Alignment:
| Q |
47 |
agctacttcagagttgagaaattttcagcggcacacttgagttttcagtt-tcaccaatcaccgcacataaactacgctgggaattatctatctatagat |
145 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||| | |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28138986 |
agctccttcagagttgagaaattttcagcgacacacttgagttttcaccaattaccattcaccgcacataaactacgctgggaattatctatctatagat |
28139085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 180 - 251
Target Start/End: Original strand, 28139142 - 28139213
Alignment:
| Q |
180 |
ttcctgctagcagctcttctttg-tctatcagaatttgaaggtcttaagtttaaaatatcatatatgcaaact |
251 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| ||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
28139142 |
ttcctgctagccgctcttcttcaatctatcagagtttgaaggt-ttaagtttaaaatatcacatatgcaaact |
28139213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University