View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17784_low_12 (Length: 275)
Name: NF17784_low_12
Description: NF17784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17784_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 175 - 273
Target Start/End: Complemental strand, 48043734 - 48043635
Alignment:
| Q |
175 |
gggattccactgctggttctaggt-aataagattgacaaacctggggatttgtctaagcaagacctgacaaaaaagatttaagtagtgtgtgatcctttg |
273 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48043734 |
gggattccactgctggttctaggttaataagattgacaaacctggggatttgtctaagcaagacctgacaaaaaagatttaagtagtgtgtgatcctttg |
48043635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 48043946 - 48043874
Alignment:
| Q |
18 |
gaactagcaggtatgatgttgatgcagccgcttatgagaatttacctgcttcaagaagtgaactccatgactt |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48043946 |
gaactagcaggtatgatgttgatgcagccgcttatgagaatttacctgcttcaagaagtgaactccatgactt |
48043874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 180 - 270
Target Start/End: Complemental strand, 48051701 - 48051611
Alignment:
| Q |
180 |
tccactgctggttctaggtaataagattgacaaacctggggatttgtctaagcaagacctgacaaaaaagatttaagtagtgtgtgatcct |
270 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
48051701 |
tccactgctggttctaagtaacaagattgataaacctggggatttgtctaagcaagacctgacagaaaaggtttaagtagtgtgtgatcct |
48051611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 187 - 264
Target Start/End: Complemental strand, 48056968 - 48056891
Alignment:
| Q |
187 |
ctggttctaggtaataagattgacaaacctggggatttgtctaagcaagacctgacaaaaaagatttaagtagtgtgt |
264 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | |||||||||||||||| |||| ||||||| |||||| ||||| |
|
|
| T |
48056968 |
ctggttcttggtaataagattgacaaacctggtgctttgtctaagcaagacacgacagaaaagatgtaagtactgtgt |
48056891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 243
Target Start/End: Complemental strand, 48045552 - 48045485
Alignment:
| Q |
176 |
ggattccactgctggttctaggtaataagattgacaaacctggggatttgtctaagcaagacctgaca |
243 |
Q |
| |
|
|||||| | |||||||| |||||||||| ||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
48045552 |
ggattcaattgctggttttaggtaataaaattgacaaacctgacaatttgtctaagcaagacccgaca |
48045485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 92 - 130
Target Start/End: Complemental strand, 48043832 - 48043794
Alignment:
| Q |
92 |
aaagaatggagtgataagggtgatctcagattcaattcc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48043832 |
aaagaatggagtgataagggtgatctcagattcgattcc |
48043794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University