View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17784_low_19 (Length: 233)
Name: NF17784_low_19
Description: NF17784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17784_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 9424483 - 9424266
Alignment:
| Q |
13 |
gagaagaaaaacaatagttagcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcctaa |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424483 |
gagaacaaaaacaatagttagcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcctaa |
9424384 |
T |
|
| Q |
113 |
gttgaccaaagcagaagcaagcttgagacatctttcataggtttctctccaagaaaatctaacatgatcattgtagatgatggaaactttgtcaccatac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424383 |
gttgaccaaagcagaagcaagcttgagacatctttcataggtttctctccaagaaaatctaacatgatcattgtagatgatggaaactttgtcaccatac |
9424284 |
T |
|
| Q |
213 |
acaggttctgctcgttca |
230 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
9424283 |
acagtggctgctcgttca |
9424266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University