View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17785_high_11 (Length: 236)
Name: NF17785_high_11
Description: NF17785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17785_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 9569437 - 9569654
Alignment:
| Q |
1 |
aaggatattgtaacccttgaatataaaattcttcaatatcagggttggaataagtgttttaaggtgtttatttgggttcagttaattgtgggaagagaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9569437 |
aaggatattgtaacccttgaatataaaattcttcaatattagggttggaataagtgttttcaggtgtttatttgggttcag----ttgtgggaagagaat |
9569532 |
T |
 |
| Q |
101 |
gtgtgctggcagagggttttgatggnnnnnnnnnnnnnnnnngtacgagtagcggacgataggtgtttagaacttgttttggtagccatcaactagttgg |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9569533 |
gtgtgctggcagagggttttgatggttttttggagttttttggtacgagtagcggacgataggtgtttagaacttgttttggtagccatcaactagttgg |
9569632 |
T |
 |
| Q |
201 |
gtagtgtatttagtggtgtttt |
222 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
9569633 |
gtggtgtatttagtggtgtttt |
9569654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University