View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17785_high_12 (Length: 223)
Name: NF17785_high_12
Description: NF17785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17785_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 22 - 190
Target Start/End: Original strand, 9569191 - 9569359
Alignment:
| Q |
22 |
acagagaggtctcgtttatctacactttatgacacctcaaatgttccttcaattaaggatagatttactgtttgaaatatgcttgtaggggttagtagtc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
9569191 |
acagagaggtctcgtttatctacactttatgacacatcaaacgttccttcaattgaggatagattcactctttgaaatatgcttgtaggggttagtagtc |
9569290 |
T |
|
| Q |
122 |
ccaaggatttttcaacccagcctgaatgcataaatttcgaatcttttggatgaacgatgcttagagccc |
190 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9569291 |
ccaaggattttgcaacccagcctgaatgcataaatttcgaatcttttggatgaacgatgcttagagccc |
9569359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University