View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17785_low_17 (Length: 203)
Name: NF17785_low_17
Description: NF17785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17785_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 14 - 188
Target Start/End: Complemental strand, 24020787 - 24020593
Alignment:
| Q |
14 |
cagagacgaaacagtacacaaagtcattagaaacacgggatcataccttgagtgatgatc--------------------ataacacgggttcacgttga |
93 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
24020787 |
cagaaacgaaacagtacacaaagtcattagaaacaccggatcgtaccttgagtgatgatcataatagagggatatccatcataacacgggttcacgtaga |
24020688 |
T |
 |
| Q |
94 |
attattgattgacacagctcagtgaatggaaatcagctataagacaatgaaaaaccctaacttatgattgcagcaaattctttgcttgatgttat |
188 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
24020687 |
aatattgattgacacagctcagtgaatgaaaatcagctatgcgacaatgaaaaaccctaacttatgattgcagcaaattcattgcttgatattat |
24020593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University