View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17785_low_9 (Length: 279)
Name: NF17785_low_9
Description: NF17785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17785_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 9736412 - 9736139
Alignment:
| Q |
1 |
tatctttaaacaataatttacacttacaattccatatcatttggnnnnnnnagcttctcccatatgtctttagttggttcaacttatgcggnnnnnnnn- |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9736412 |
tatctttaaacaataatttacacttacaattccatatcatttggtttttttagcttctcccatatgtctttagttggttcaacttatgcgaaaaaaaaaa |
9736313 |
T |
 |
| Q |
100 |
-tgaacactttaaattttcaagctaataaggctactaagtattactgaataagggtatacttataaagtgctcttgtaggaaatgttgaagttgtgtcaa |
198 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
9736312 |
atgaatactttaaattttcaagctaataaggctactaagtattactgaataagggtatacttataaagtgctctgattggaaatgttgaagttgtgtcaa |
9736213 |
T |
 |
| Q |
199 |
ataaaatgtatcatatgcatcacaaatatcacattagaggattgtcacccagtaaaatctctgctcaatctgtg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9736212 |
ataaaatgtatcatatgcatcacaaatatcacattagaggattgtcacccagtaaaatctctgctccatctgtg |
9736139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University