View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17786_high_10 (Length: 202)
Name: NF17786_high_10
Description: NF17786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17786_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 20 - 187
Target Start/End: Complemental strand, 10249908 - 10249742
Alignment:
| Q |
20 |
ttaacctgtcaaaatcatgtatgcacttatagaatcaatttccaatatgtaacaaaaagataaaaattatattgtcctacatcttcaattttataccact |
119 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
10249908 |
ttaacctttcaaaatcatgtatgcacttatagaatcaatttccaatatgtaacaaaaagataaaa-ttatattgtcctacatcttcaattttatgccact |
10249810 |
T |
|
| Q |
120 |
agctataacttctaagtaacatttttctttttgtcaaacatctttgatttggagggatcagacttcat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10249809 |
agctataacttctaagtaacatttttctttttgtcaaacatctttgatttggaggtatcagacttcat |
10249742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University