View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17786_low_10 (Length: 303)
Name: NF17786_low_10
Description: NF17786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17786_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 13 - 111
Target Start/End: Original strand, 48673729 - 48673826
Alignment:
| Q |
13 |
aaaatgtgacaactgcgtttaaaattgcagatatgatgtcattgcagagccttttaaaacccgtaatattgagtccgcaattacgattgtagatcacaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48673729 |
aaaatgtgacaactgcgtttaaaattgcagatatgatgtcattgcagagcc-tttaaaacccgtaatattgagtccgcaattatgattgtagatcacaa |
48673826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 176 - 285
Target Start/End: Original strand, 48673885 - 48673994
Alignment:
| Q |
176 |
ccttatcaactgagttaaactcacgtggatatatgacaatttaaaactatgattatcaccacgcacataaaatatcatcttaaattatgagtcatactca |
275 |
Q |
| |
|
||||| ||||||||||||||||||||| | | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48673885 |
ccttaccaactgagttaaactcacgtgaacagatgacaatttaaaactatgattatcactacgcacataaaatatcatcttaaattatgagtcacactca |
48673984 |
T |
 |
| Q |
276 |
atcgtgcaaa |
285 |
Q |
| |
|
||| |||||| |
|
|
| T |
48673985 |
atcctgcaaa |
48673994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University