View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17787_high_21 (Length: 218)
Name: NF17787_high_21
Description: NF17787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17787_high_21 |
 |  |
|
| [»] scaffold0252 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0252 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: scaffold0252
Description:
Target: scaffold0252; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 136 - 201
Target Start/End: Complemental strand, 22537 - 22476
Alignment:
| Q |
136 |
ttataagaacaataatactaaaattcctccaaacttttatctatccacttcattgttgtcattagt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22537 |
ttataagaacaataatactaaaattcctccaaacttt----tatccacttcattgttgtcattagt |
22476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0252; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 22664 - 22611
Alignment:
| Q |
9 |
gaggagcagagatcatggattgactagggtgctttataatataattaagctatt |
62 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22664 |
gaggaccatagatcatggattgactagggtgttttataatataattaagctatt |
22611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 9 - 62
Target Start/End: Original strand, 34660094 - 34660147
Alignment:
| Q |
9 |
gaggagcagagatcatggattgactagggtgctttataatataattaagctatt |
62 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
34660094 |
gaggaccagagatcatggattgattagggtgctttataatataaataagctatt |
34660147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 201
Target Start/End: Original strand, 34660234 - 34660279
Alignment:
| Q |
152 |
actaaaattcctccaaacttttatctatccacttcattgttgtcattagt |
201 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34660234 |
actaaaattcctccaaacttt----tatccacttcattgttgtcattagt |
34660279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University