View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17787_low_26 (Length: 222)
Name: NF17787_low_26
Description: NF17787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17787_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 22 - 205
Target Start/End: Original strand, 11726894 - 11727078
Alignment:
| Q |
22 |
cagctattcaattttcgcagttatggtgcca-ccttcttaggaatcacgaagattgtcaggtttccatatagggcaagagagtttgcgatcaagaaaaat |
120 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11726894 |
cagctatttaattttcgcggttagggtgccaaccttcttaggaatcacgaacattgtcaggtttccatatagggctagagagtttgcgatcaagaaaaat |
11726993 |
T |
|
| Q |
121 |
catgttctattttatcttcaagtattcaagatcgtgacaacaatcatcgtagcaattgatagtttcaaaaatagatgctctagct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11726994 |
catgttctattttatcttcaagtattcaagatcgtgacaacaatcatagtagcaattgatagtttcaaaaatagatgctctagct |
11727078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University