View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17788_low_10 (Length: 216)
Name: NF17788_low_10
Description: NF17788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17788_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 33 - 199
Target Start/End: Complemental strand, 22041357 - 22041193
Alignment:
| Q |
33 |
aaacacaatcaaacaaattagagcaacacggtaactaatttcaatcacttaagcggtagcaacaaattagagaagnnnnnnnnnnntgaaactctagaga |
132 |
Q |
| |
|
|||||| || || |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
22041357 |
aaacacgatgaatcaaattagagcaacacggcaactaatttcaatcacttaagtagtagcaacaaattagagaagaaaaaaaat--tgaaactctagaga |
22041260 |
T |
 |
| Q |
133 |
agtggaatggaaaatccataagaaaactgcacatttatttatgttaattaaagaacttacttgtttg |
199 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22041259 |
agttgaatggaaaatccataagaaaactgcacatttatttatgttaattaaagaacttacttgtttg |
22041193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University