View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17788_low_6 (Length: 339)
Name: NF17788_low_6
Description: NF17788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17788_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 116 - 322
Target Start/End: Original strand, 9687343 - 9687555
Alignment:
| Q |
116 |
tcctattgtgccaagaaaaaataggaaccgtattctcaatttatggagaacatgtcatggtggtgatcaaaataatttaagtttgaagtattccaagtaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9687343 |
tcctattgtgccaagaaaaaataggaaccgtattctcaatttatgaagaacgtgtcatggtggtggtcaaaataatttaagtttgaagtattccaagtaa |
9687442 |
T |
 |
| Q |
216 |
aaaacctatcgttttgccaatcttttctcaacaaacattttactgttaaata------aaaaataaaattcctattctattataaattaaattcaatggc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9687443 |
aaaacctatcgttttgccaatcttttctcaacaaacattttactgttaaataaaaaagaaaaaaaaaattcctattctattataaattaaattcaatggc |
9687542 |
T |
 |
| Q |
310 |
tgcaactttttat |
322 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9687543 |
tgcaactttttat |
9687555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University