View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17789_high_17 (Length: 213)

Name: NF17789_high_17
Description: NF17789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17789_high_17
NF17789_high_17
[»] chr6 (2 HSPs)
chr6 (18-115)||(9666241-9666338)
chr6 (179-213)||(9666227-9666261)


Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 9666338 - 9666241
Alignment:
18 ctaggcggaattggtgaaattactgaactacccccaccatctcccacagacccatcatcacatacaccttgaaaattacatccaataccaaaactcac 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
9666338 ctaggcggaattggtgaaattactgaactacccccaccatctcccacagacccatcatcacatacaccttgaaaattacatccaacaccaaaactcac 9666241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 9666261 - 9666227
Alignment:
179 acatccaacaccaaaactcactgacccattttcac 213  Q
    |||||||||||||||||||||||||||||||||||    
9666261 acatccaacaccaaaactcactgacccattttcac 9666227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University