View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17789_high_19 (Length: 201)
Name: NF17789_high_19
Description: NF17789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17789_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 13 - 183
Target Start/End: Original strand, 24885037 - 24885207
Alignment:
| Q |
13 |
cagagagtgagtacgaggcctgacctgagagattctttaataagaaggtggcctttgagcttaatttggccaagttggagccgacgttgttgattacaag |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24885037 |
cagagagtgagtacgaggcctgagctgagagattctttaataagaaggtggcctttgagcttaatttggccaagttggagccgacgttgttgattacaag |
24885136 |
T |
 |
| Q |
113 |
gacaagcatgaaatttagatgggtgtgatcatgaagttttctcataaagacaaagaaatccaggccctaac |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24885137 |
gacaagcatgaaatttagatgggtgtgattatggagtgttctcataaagacaaagaaatccaggccctaac |
24885207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University