View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17789_high_9 (Length: 261)
Name: NF17789_high_9
Description: NF17789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17789_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 2 - 249
Target Start/End: Original strand, 52584252 - 52584499
Alignment:
| Q |
2 |
gttagattctccaccacaggttgattacaaggctcacgtgtctgatcttgaccaggcatgaagtaacttggattgatcataagaccttgatttaaggaac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584252 |
gttagattctccaccacaggttgattacaaggctcacgtgtctgatcttgaccaggcatgaagtaacttggattgatcataagaccttgatttaaggaac |
52584351 |
T |
 |
| Q |
102 |
ggtttctgtattcatcaacaagcatgtgagagcctaaagaaagggataggccttgttgtgtctggtgattattctcgtttgctgcaccaagtagatccat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584352 |
ggtttctgtattcatcaacaagcatgtgagagcctaaagaaagggataggccttgttgtgtctggtgattattctcgtttgctgcaccaagtagatccat |
52584451 |
T |
 |
| Q |
202 |
caaatgtcttgtgtgactcatctcagaaccttgtgctagcccaatatt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584452 |
caaatgtcttgtgtgactcatctcagaaccttgtgctagcccaatatt |
52584499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University