View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17789_low_16 (Length: 244)
Name: NF17789_low_16
Description: NF17789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17789_low_16 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 32 - 244
Target Start/End: Complemental strand, 3880688 - 3880476
Alignment:
| Q |
32 |
ctcatctcacaaaaatcaagtataaattgtataataaatcaatgtcacttacagggcaaaatgatgcatattccaaatgatcacaactgtccaaaatgac |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3880688 |
ctcatctcacaaaaatcaagtataaattgtataataaatcaatgtcacttacagggcaaaatgatgcatattccaaatgatcacagctgtccaaaatgac |
3880589 |
T |
 |
| Q |
132 |
cttctcaagattagggcaggttagctcaagagtagtgattgctcgacaaccgcctagagaaagactgattatcgaggtgctgatgaagcgaactgaagtc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3880588 |
cttctcaagattagggcaggttagctcaagagtagtgattgctcgacaaccgcctagagaaagactgattatcgaggtgctgatgaagcgaactgaagtc |
3880489 |
T |
 |
| Q |
232 |
aggctctacatgc |
244 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3880488 |
aggctctacatgc |
3880476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 63 - 244
Target Start/End: Complemental strand, 3866782 - 3866601
Alignment:
| Q |
63 |
taataaatcaatgtcacttacagggcaaaatgatgcatattccaaatgatcacaactgtccaaaatgaccttctcaagattagggcaggttagctcaaga |
162 |
Q |
| |
|
||||| |||| | ||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||| |||||| |||||||||||| |
|
|
| T |
3866782 |
taatatatcagtatcacttacagggcaaaatgatgcattttccaaatgatcacaaccatccaatatgaccttctcaagataagggcatgttagctcaaga |
3866683 |
T |
 |
| Q |
163 |
gtagtgattgctcgacaaccgcctagagaaagactgattatcgaggtgctgatgaagcgaactgaagtcaggctctacatgc |
244 |
Q |
| |
|
||||| | |||||| ||||| || || || ||||||| || ||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
3866682 |
gtagtaactgctcggcaaccaccaagggagagactgactaacgaggtgctgatgaaccgaactgaagtcaagctctacatgc |
3866601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University