View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17789_low_18 (Length: 237)
Name: NF17789_low_18
Description: NF17789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17789_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 43780425 - 43780650
Alignment:
| Q |
1 |
cccaagagttttgctgcctgtccacctaatagtgattgtattgggctctannnnnnnccccagtatgaaaggtatgctccttcaatg-----tattttgc |
95 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43780425 |
cccaagcgttttgctgcctgtccacctaatagtgattgtattgggctctatttttttccccagtatgaaaggtatgctccttcaatggattatattttgc |
43780524 |
T |
|
| Q |
96 |
atactaattggtaagctcatgttctagatttcccttggctttttggtaaatagggatgagatgatctttgatcgtgtgctggacatcgtgattgaaaaag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43780525 |
atactaattggtaagctcatgttctagatttcccttggttttttggtaaatagggatgagatgatctttgatcgtgtgctggacaacgtgattgaaaaag |
43780624 |
T |
|
| Q |
196 |
ataacgctctcaaagcagtcattaac |
221 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
43780625 |
ataatgctctcaaagcagtcattaac |
43780650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University