View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17789_low_21 (Length: 213)
Name: NF17789_low_21
Description: NF17789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17789_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 9666338 - 9666241
Alignment:
| Q |
18 |
ctaggcggaattggtgaaattactgaactacccccaccatctcccacagacccatcatcacatacaccttgaaaattacatccaataccaaaactcac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9666338 |
ctaggcggaattggtgaaattactgaactacccccaccatctcccacagacccatcatcacatacaccttgaaaattacatccaacaccaaaactcac |
9666241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 9666261 - 9666227
Alignment:
| Q |
179 |
acatccaacaccaaaactcactgacccattttcac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666261 |
acatccaacaccaaaactcactgacccattttcac |
9666227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University