View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17789_low_8 (Length: 393)
Name: NF17789_low_8
Description: NF17789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17789_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 123 - 386
Target Start/End: Original strand, 45310475 - 45310739
Alignment:
| Q |
123 |
gaatactctagatgtcatgaattatatatccatgatcaacatattaannnnnnnnaaaa-ttgttcttatgtagatgtcaacattgaggatgattgtgtt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45310475 |
gaatactctagatgtcatgaattatatatccatgataaacatattaatttttaaaaaaaattgttcttatgtagatgtcaacattgaggatgattgtgtt |
45310574 |
T |
|
| Q |
222 |
aatgaactttgtgggatttggcacgattgtcttgttaactcacttcctagcaaaacaagaagaaggacgtatcaagcttcttggatggatttgtgtagtt |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45310575 |
gatgaactttgtgggatttggcacgattgtcttgttaactcacttcctagcaaaacaagaagaaggacgtatcaagcttcttggatggatttgtgtagtt |
45310674 |
T |
|
| Q |
322 |
tttgctactagtgtttttgctgcccctttaagcattatcgtgagtgcatcttaattaatattctt |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45310675 |
tttgctactagtgtttttgctgcccctttaagcattatcgtgagtgcatcttaattaacattctt |
45310739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 16 - 122
Target Start/End: Original strand, 45310344 - 45310450
Alignment:
| Q |
16 |
tttgttacttactgccccaagaaagttagggtacgtgtataagagtgatatgcatattaaattttacttgcatagctaaagttgctacgatgttattagt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45310344 |
tttgttacttactgccccaagaaagttagggtacgtgtataagagtgatatgcatattaaattttacttgcatagctaaagttgctaggatgttattagt |
45310443 |
T |
|
| Q |
116 |
tgtcaca |
122 |
Q |
| |
|
||||||| |
|
|
| T |
45310444 |
tgtcaca |
45310450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University