View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1778_low_3 (Length: 339)
Name: NF1778_low_3
Description: NF1778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1778_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 96 - 327
Target Start/End: Original strand, 23075891 - 23076122
Alignment:
| Q |
96 |
aaatgtgaatttgggggtcactttgtgtcgttgtatgactcgagggttggctcacgaaagtgatgaagaatgaaaatattttgaatttctttagagaaag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23075891 |
aaatgtgaatttgggggtcactttgtgtcgttgtatgactcgagggttggctcgcgaaagtgatgaagaatgaaaatattttgaatttctttagagaaag |
23075990 |
T |
|
| Q |
196 |
gttaaaacaccttgggaaataatttggttgtctccaccctctgtgtctagttatggaggttctccatttcttgccccaactcgctccctccctatatctt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23075991 |
gttaaaacaccttgggaaataatttggttgtctccaccctctgtgtctagttatggaggttctccatttcttgccccaactcgctccctccctatatctt |
23076090 |
T |
|
| Q |
296 |
tctctcgatgttctatttgtttataggtttca |
327 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |
|
|
| T |
23076091 |
tctctcaatgttctatttgtttataggtttca |
23076122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 28661273 - 28661345
Alignment:
| Q |
1 |
taaaattcatatataaaattcactcaatcaaatcatatgagtgacaacatcaaaatcttccatttctcagttc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28661273 |
taaaattcatatataaaattcactcaatcaaatcatatgagtgacaacatcaaaatcttccatttctcagttc |
28661345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University