View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1778_low_9 (Length: 215)
Name: NF1778_low_9
Description: NF1778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1778_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 111 - 187
Target Start/End: Complemental strand, 7314127 - 7314050
Alignment:
| Q |
111 |
gttgcgaacccatagttgaatcctcgcaaaccctcaatcaggtattgctgaaact-acatgattaatttgttcactaa |
187 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7314127 |
gttgtgaacccatagttgaatcctcgcaaaccctcaatcaggtattgctgaaactaacatgattaatttgttcactaa |
7314050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University