View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17791_high_19 (Length: 255)
Name: NF17791_high_19
Description: NF17791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17791_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 4015722 - 4015586
Alignment:
| Q |
13 |
cacagacacgaaacccttcgctcttaacaataatcacgaagaacacaatctgtattccgggatatcacgttgaacataaggaagaattcagcatcgttag |
112 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4015722 |
cacagacacgaaactcttcgctcttaaaaataatcacgaagaacacaatctgtattccgggatatcacgttgaacataaggaagaattcagcatcgttag |
4015623 |
T |
 |
| Q |
113 |
acaccctatacatcgtgtattccaaaaccattccttc |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4015622 |
acaccctatacatcgtgtattccaaaaccattccttc |
4015586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 155 - 241
Target Start/End: Complemental strand, 4015520 - 4015434
Alignment:
| Q |
155 |
gatagttgattcctgtaatggattgcttcttttggaagttgtttctaaaactgtttatggttttgagtactggctctgtgtttggaa |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4015520 |
gatagttgattcctgtaatggattgcttcttttggaagttgtttctgaaactgtttatggttttgagtactggctctgtgtttggaa |
4015434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University