View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17791_high_20 (Length: 238)
Name: NF17791_high_20
Description: NF17791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17791_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 109 - 206
Target Start/End: Complemental strand, 7776239 - 7776135
Alignment:
| Q |
109 |
ttaatgaatattgctaatcgatatataaaactcgcatt-----ataa--acccgattatatgttctgtttatttcagatctactacatgaattcaacaca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7776239 |
ttaatgaatattgctaatcgatatataaaactcgcatttgctaataataaatcgattatatgttctgtttatttcagatctactacatgaattcaacaca |
7776140 |
T |
|
| Q |
202 |
tacat |
206 |
Q |
| |
|
||||| |
|
|
| T |
7776139 |
tacat |
7776135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 7776119 - 7776085
Alignment:
| Q |
188 |
atgaattcaacacatacataaatgtcacaaattgt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7776119 |
atgaattcaacacatacataaatgtcacaaattgt |
7776085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University