View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17791_high_21 (Length: 233)
Name: NF17791_high_21
Description: NF17791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17791_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 51995893 - 51995686
Alignment:
| Q |
1 |
tagactaccaggacaccactatggtgcaacactggatgaataatatgtaccattgaaagtggacgctttctttgtcgggataaaatnnnnnnnnnncaca |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
51995893 |
tagactaccagtacaccactatggtgcaaaacttgatgaataatatgtaccattgaaagtggacgctttctttgtcgggataaattaaaaaaaa--caca |
51995796 |
T |
 |
| Q |
101 |
acagtatgaaaaaatgtctaaagataattagtattgtatttcaggtcagataatgaatccttctttttaaagtcatgaaaaaacaaatttatttattact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51995795 |
acagtatgaaaaaatgtctaaagataattagtattgtatttcaggtcagataatgaatccttctttttaaagtcatgaaaaaacaaatt----tattact |
51995700 |
T |
 |
| Q |
201 |
ttattgatggacat |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
51995699 |
ttattgatggacat |
51995686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University