View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17791_low_13 (Length: 348)
Name: NF17791_low_13
Description: NF17791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17791_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 194
Target Start/End: Complemental strand, 11089752 - 11089724
Alignment:
| Q |
166 |
gggtatgaattcaatttttgcctcttctg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11089752 |
gggtatgaattcaatttttgcctcttctg |
11089724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University