View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17791_low_20 (Length: 306)
Name: NF17791_low_20
Description: NF17791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17791_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 296
Target Start/End: Original strand, 27726841 - 27727120
Alignment:
| Q |
18 |
aaaatatcccattttttatagttagaattattcttctattatgaatgaaatcccatactgatttgacaccaaattctatcttttatttttgctcactact |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27726841 |
aaaatatctcattttttatagttagaattattcttctattatgaatgaaatcccatactgatttgacaccaaattctatcttttatttttgctcactact |
27726940 |
T |
 |
| Q |
118 |
tttcactcagcttgaaaagtgttgcatatgttaaaaacttgttaatc-tatgttttagttgaatctctcatgtgaacaaagccctgaatacactctttaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27726941 |
tttcactcagcttgaaaagtgttgcatatgttaaaaacttgttaatcttatgttttagttgaatctctcatgtgaacaaagccctgaatacactctttaa |
27727040 |
T |
 |
| Q |
217 |
aattttactgttagaccctacnnnnnnngaaatctaactttcattctccacatattttctgttagtaagtttagtctctg |
296 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27727041 |
aattttactgttagaccctacaaaaaaagaaatctaactttcattctccacatattttctgttagtaagtttagtctctg |
27727120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 26594638 - 26594606
Alignment:
| Q |
262 |
ctccacatattttctgttagtaagtttagtctc |
294 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
26594638 |
ctccacatattttctgttagtaaatttagtctc |
26594606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University