View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17791_low_28 (Length: 237)
Name: NF17791_low_28
Description: NF17791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17791_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 35 - 229
Target Start/End: Complemental strand, 31114667 - 31114472
Alignment:
| Q |
35 |
gtccatgaatcgtccaaagtgaacccagttcactgtgtttatgggatacaagcttctatcatcaatgcagataatggagagtgagtggcataatgggatc |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31114667 |
gtccatgaatcgaccaaagtgaacccagttcactgtgtttctgggatacaagcttctatcatcaatgcagataatggagagtgagtggcataatgggacc |
31114568 |
T |
|
| Q |
135 |
cacctctttgaatggacattggttct-aaagcttatttgattgggagaaaagacagaatgtgggtaaccatctcgtctaggaagttgttgatgatg |
229 |
Q |
| |
|
|| ||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114567 |
caactcttagaaaggacattggttctaaaagcttatttgattgggagaaaagacagaatgtgggtaaccatctcgtctaggaagttgttgatgatg |
31114472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 31088600 - 31088499
Alignment:
| Q |
19 |
ggttgaacataattgcgtccatgaatcgtccaaagtgaacccagttcactgtgtttatgggatacaagcttctatcatcaatgcagataatggagagtga |
118 |
Q |
| |
|
||||||||||||||| |||| ||||| | |||||||||||| ||| |||||||| | |||| |||||| ||||||||| || || || |||||||| |
|
|
| T |
31088600 |
ggttgaacataattgtatccacgaatcaacgaaagtgaacccacttctctgtgtttctttgatagaagcttatatcatcaaagcggacaacagagagtga |
31088501 |
T |
|
| Q |
119 |
gt |
120 |
Q |
| |
|
|| |
|
|
| T |
31088500 |
gt |
31088499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University