View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17791_low_9 (Length: 367)
Name: NF17791_low_9
Description: NF17791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17791_low_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 44 - 367
Target Start/End: Original strand, 35005519 - 35005842
Alignment:
| Q |
44 |
catttggttgatagggtccaattcctgttcggaagtggttctttgctaaacacactcaataccactgttctctttatgagtggaaggtggagccgattct |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35005519 |
catttggttgatagggtccaattcctgttcggaagtggttctttgctaaacacactcaataccactgttctctttatgagtggaaggtggagccgattct |
35005618 |
T |
|
| Q |
144 |
ttgttggcgcgagtagggttttgtgtgctgggcatagatgcatttgatctgtgctttgtgcgtttgggtgggccctagatttctgcggtccttctgcttg |
243 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35005619 |
ttgttggcacgagtagggttttgtgtgctgggcatagatggatttgatctgtgctttgtgcgtttgggtgggccctagatttctgcggtccttctgcttg |
35005718 |
T |
|
| Q |
244 |
gtggttttctcttggctttgctgcttctggtagtgctggcggggtggagcttttggagtgcttttgttgtggatgttcctaggggtgccgttttagtttt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35005719 |
gtggttttctcttggctttgctgcttctggtagtgctggcgggggggaggttttggagtgcttttgttgtggatgttcctaggggtgccattttagtttt |
35005818 |
T |
|
| Q |
344 |
ggcttcttggtttgtacttgtgct |
367 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
35005819 |
ggcttcttggtttgttcttgtgct |
35005842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 74 - 159
Target Start/End: Original strand, 8766105 - 8766190
Alignment:
| Q |
74 |
ggaagtggttctttgctaaacacactcaataccactgttctctttatgagtggaaggtggagccgattctttgttggcgcgagtag |
159 |
Q |
| |
|
|||| |||||| ||||||||||| || | || | ||||| |||||||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
8766105 |
ggaattggttcattgctaaacacccttcacactagtgttcattttatgagtggaaggtggagtcaattctttgttggcgccagtag |
8766190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 116 - 148
Target Start/End: Original strand, 9500222 - 9500254
Alignment:
| Q |
116 |
tttatgagtggaaggtggagccgattctttgtt |
148 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
9500222 |
tttatgagtggaaggtggagccaattctttgtt |
9500254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University