View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_high_104 (Length: 221)
Name: NF17793_high_104
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_high_104 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 36 - 209
Target Start/End: Complemental strand, 43636108 - 43635935
Alignment:
| Q |
36 |
ggggtgagttttagttagatatattttcttatgcaaaaattgaatttttctatatataattcaaaaatagtggctaatgaatttttgggttgttttcaga |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43636108 |
ggggtgagttttagttagatatattttcttatgcaaaaattgaatttttctatatataattcaaaaatagtggcttatgaatttttgggttgttttcaga |
43636009 |
T |
 |
| Q |
136 |
aaaggcctcatcttcaaagttgttaaacttatgtgttcttcattgtatcaaacttctgtaatagggcacaggtt |
209 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43636008 |
aaaggtctcatcttcaaagttgttaaacttatgtgttcttcattgtatcaaacttctgtaatagggcacaggtt |
43635935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University