View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17793_high_114 (Length: 206)

Name: NF17793_high_114
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17793_high_114
NF17793_high_114
[»] chr2 (1 HSPs)
chr2 (98-187)||(23345092-23345184)


Alignment Details
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 98 - 187
Target Start/End: Complemental strand, 23345184 - 23345092
Alignment:
98 aagaaaaacatcctaaaatactatctcgtcattactaatggtat---taacatcctaaaatactttctcgtcattaacaatggtataattaac 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||| ||||||||||||||||||||||||    
23345184 aagaaaaacatcctaaaatactatctcgtcattactaatggtatgattaacatcctaaaatactttcttgtcattaacaatggtataattaac 23345092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University