View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_high_28 (Length: 430)
Name: NF17793_high_28
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 1e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 5 - 107
Target Start/End: Complemental strand, 45759102 - 45759000
Alignment:
| Q |
5 |
gtcagtgggagccaatctgaggaggctccgaatgtggaaattagttgttgaagttttgaagaaaacatcgggtagttggaggaataagttcgttagtctt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45759102 |
gtcagtgggagccaatctgaggaggctccgaatgtggaaattagttgttgaagttttggagaaaacatcgggtagttggaggaataagttcgttagtctt |
45759003 |
T |
 |
| Q |
105 |
gga |
107 |
Q |
| |
|
||| |
|
|
| T |
45759002 |
gga |
45759000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 347 - 414
Target Start/End: Complemental strand, 45759000 - 45758933
Alignment:
| Q |
347 |
aaagataataacgttttctttgtaaaaacacttcttcatcggttgtccactcgtagaagtctagttag |
414 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45759000 |
aaagataataaggttttctttgtaaaaacacttcttcatcggttgtccactcgtagaagtatagttag |
45758933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University