View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_high_78 (Length: 268)
Name: NF17793_high_78
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_high_78 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 24 - 244
Target Start/End: Complemental strand, 32740015 - 32739800
Alignment:
| Q |
24 |
cagcatcctgtcatggaggcagcggtattcaatgaactgtttcttaaactgctgtcaatttttccggcagcgcaatctgttagccaagcaaatctagtgc |
123 |
Q |
| |
|
||||| || ||||||||||||| || |||| ||||||||||| ||||| |||| |||||||||| |||||| ||||||||| ||||||||| |||||||| |
|
|
| T |
32740015 |
cagcacccagtcatggaggcagagggattctatgaactgttttttaaaatgctttcaatttttctggcagcacaatctgtttgccaagcaagtctagtgc |
32739916 |
T |
 |
| Q |
124 |
acttgcaaggtgagtgaaggaacgagctagtctgggaaaatttgcagaaaccgattcagattttagtagcagctgaatttgtttatggcgcgattgggaa |
223 |
Q |
| |
|
| ||| | |||||| ||||||||||| || |||| ||||| ||||| |||||||||||||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
32739915 |
atttgga-----agtgaacgaacgagctagactcggaacatttggtaaaaccagttcagattttagtagcagctgaatttttttgtggcgtgattgggaa |
32739821 |
T |
 |
| Q |
224 |
acagagagtataccagaaaca |
244 |
Q |
| |
|
|||| | ||||| || ||||| |
|
|
| T |
32739820 |
acagcgcgtataacataaaca |
32739800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 64 - 172
Target Start/End: Original strand, 9574789 - 9574893
Alignment:
| Q |
64 |
ttcttaaactgctgtcaatttttcc-ggcagcgcaatctgttagccaagcaaatctagtgcacttgcaaggtgagtgaaggaacgagctagtctgggaaa |
162 |
Q |
| |
|
|||||||||| |||| ||||||| | |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9574789 |
ttcttaaacttctgtaaattttttctggcagcgcaatctgttagccaagcaaatctagtgcacttgca-----agtgaaggaacgagctagtctgggaaa |
9574883 |
T |
 |
| Q |
163 |
atttgcagaa |
172 |
Q |
| |
|
|||||||||| |
|
|
| T |
9574884 |
atttgcagaa |
9574893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University