View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_high_79 (Length: 266)
Name: NF17793_high_79
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_high_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 22 - 259
Target Start/End: Complemental strand, 38482971 - 38482734
Alignment:
| Q |
22 |
gaggtggtgcgagtggttggcatgtcattggagttgggaagagagagtgtgactgtgtgttatgattttgttgttggttagtttagttagttagagagaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
38482971 |
gaggtggtgcgagtggttggcatgtcattggagttgggaagagagagtgtgactgtgtgttatgattctgttattggttagtttagttagttagagagaa |
38482872 |
T |
 |
| Q |
122 |
aagaatgagaagtggtcttgtgagagtaacggtcatcgcgggaaatgatagacnnnnnnnggcgcgttacttaacacgtgtatctacattttatgtctaa |
221 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38482871 |
aagaatgagaagtggtcttgtgagtgtaacggtcatcgcgggaaatgatagacaaaaaaaggcgcgttacttaacacgtgtatctacattttatgtctaa |
38482772 |
T |
 |
| Q |
222 |
gatacattatatgggttctttttctttgatattcttgg |
259 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
38482771 |
gatacagtatatgggttctttttctttgatatacttgg |
38482734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University