View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_high_85 (Length: 253)
Name: NF17793_high_85
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_high_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 120 - 238
Target Start/End: Original strand, 32273027 - 32273145
Alignment:
| Q |
120 |
ggtcccgtcataatagaccctgtaccnnnnnnnggaacgccattgaccatttgtttgataaaatcattgaaatagtatcttttaataatctcatataatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32273027 |
ggtcccgtcataatagaccctgtaccaaaaaaaggaactccattgaccatttgtttgataaaatcattgaaatagtatcttttaataatctcatataatt |
32273126 |
T |
|
| Q |
220 |
atgagctctagggcctttg |
238 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
32273127 |
atgagctctagggtctttg |
32273145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 32272908 - 32272952
Alignment:
| Q |
1 |
ttttttaatatctatatagaaaaatgatagctttttctatgattc |
45 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32272908 |
ttttttaatatctatttagaaaaatgatagctttttctatgattc |
32272952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University