View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_high_94 (Length: 236)
Name: NF17793_high_94
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_high_94 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 11897822 - 11897602
Alignment:
| Q |
1 |
cgaaaacatcgaagcaaaccaaaactattttacggctgaagttaaccatattaccaaaaggtcattcgacaaaatctggtgaatatagcgccatgtgtgt |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
11897822 |
cgaaaacatcgaagcatgccaaaactattttacggcagaagttaaccatattaccaaaaggtcattcgacaaaatctggttaacatagcgccatgtgtgt |
11897723 |
T |
 |
| Q |
101 |
tagtagattatggttttgtgcaccataaaaatgcgttttgctatgtaaaactccaccccccactcattgatttgtatgag--agggaagtaatgggagag |
198 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||| |||| ||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
11897722 |
tagtaaattatggttttgtgcaccaaaaaaatgtgttttgctatgtaaaactcca-ccccaactcattgatttgtatgagataaggaagtaatgggagag |
11897624 |
T |
 |
| Q |
199 |
caaacccagaggaaggggtaat |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11897623 |
caaacccagaggaaggggtaat |
11897602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University