View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_102 (Length: 233)
Name: NF17793_low_102
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_102 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 21 - 219
Target Start/End: Complemental strand, 36465234 - 36465036
Alignment:
| Q |
21 |
gattacaggtggagcaggagcaactgttttatacaacttgaggcaaagacatccaacacttgacctgcctgtgattgactatgatttagcacttcttttt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465234 |
gattacaggtggagcaggagcaactgttttatacaacttgaggcaaagacacccaacacttgacctgcctgtgattgactatgatttagcacttcttttt |
36465135 |
T |
 |
| Q |
121 |
caaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgactggatgataacatctttgatactaatatttttcacaggt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465134 |
caaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgactggatgataacatctttgatactaatatttttcacaggt |
36465036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 21 - 215
Target Start/End: Complemental strand, 36474412 - 36474218
Alignment:
| Q |
21 |
gattacaggtggagcaggagcaactgttttatacaacttgaggcaaagacatccaacacttgacctgcctgtgattgactatgatttagcacttcttttt |
120 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36474412 |
gattactggtggagcaggagcaactgttttatacaacttgaagaaaagacacccaacacttgacctgcctgtgattgactatgatttagcacttcttttc |
36474313 |
T |
 |
| Q |
121 |
caaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgactggatgataacatctttgatactaatatttttcac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| ||||| ||||| || | ||||||||||| |
|
|
| T |
36474312 |
caaccaatgttaatgcttggaatcagtcttggtgttgctttcaatctcattttccctgactggatgttaacaactttgctaatcatatttttcac |
36474218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University