View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_103 (Length: 231)
Name: NF17793_low_103
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_103 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 21 - 215
Target Start/End: Original strand, 7578023 - 7578220
Alignment:
| Q |
21 |
acactcaagttacaggtatcctagacgaacctaaccaactacttttccttataaacaaaattctgcatgaaaattatatagcaaggtaactaaagaaact |
120 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7578023 |
acactcaagttacaagtatcctagacgaacctaaccaactacttttccttataaacaaaattctgcatgaaaattatatagcaaggtaactaaagaaact |
7578122 |
T |
|
| Q |
121 |
caaaaatgaagaacactgcattatttagagagcacagatcaccggatgtgaatggtctaatttgaacc---aagaccttcttttttgtgttcactctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||| |
|
|
| T |
7578123 |
caaaaatgaagaacactgcattatttagagagcacagatcaccggatgtgaatggtctaatttgaaccaagaagacctacttttttgtgttaactctc |
7578220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University