View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_106 (Length: 225)
Name: NF17793_low_106
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_106 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 33 - 210
Target Start/End: Original strand, 43037453 - 43037631
Alignment:
| Q |
33 |
ccattgtggaaaatattgggggaagagaatgaggtaggtaattgaatgggaagaaggacacgaccgagtagcttggcattgcggacgccacagttgcggc |
132 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43037453 |
ccattgtggaaagtattgggggaagagaatgaggtaggtaattgaatgggaagaaggacacgaccgagtagcttggcattgcggacgccacagttgcggc |
43037552 |
T |
 |
| Q |
133 |
caattgggccgttgtaaacaaagatggagag-gtgaggagtttgccggagagacgatggagagcggcatagtcaaggtg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43037553 |
caattgggccgttgtaaacaaagatggagagagtgaggagtttgccggagagacgatggagagcagcatagtcaaggtg |
43037631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University