View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_107 (Length: 223)
Name: NF17793_low_107
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_107 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 10 - 130
Target Start/End: Complemental strand, 28481279 - 28481159
Alignment:
| Q |
10 |
gaagaatataaagaaccttttgaattgagatatcatctctattttcaatggtgctagctccttggttattattattcatggaagcttcagttgccatggt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28481279 |
gaagaatataaagaaccttttgaattgagatatcatctctattttcaatggtgctagctccttggttattattattcatggaagcttcagttgccatggt |
28481180 |
T |
 |
| Q |
110 |
caatggggaacccaccaaacc |
130 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28481179 |
caatggggaacccaccaaacc |
28481159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University