View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17793_low_107 (Length: 223)

Name: NF17793_low_107
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17793_low_107
NF17793_low_107
[»] chr1 (1 HSPs)
chr1 (10-130)||(28481159-28481279)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 10 - 130
Target Start/End: Complemental strand, 28481279 - 28481159
Alignment:
10 gaagaatataaagaaccttttgaattgagatatcatctctattttcaatggtgctagctccttggttattattattcatggaagcttcagttgccatggt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28481279 gaagaatataaagaaccttttgaattgagatatcatctctattttcaatggtgctagctccttggttattattattcatggaagcttcagttgccatggt 28481180  T
110 caatggggaacccaccaaacc 130  Q
    |||||||||||||||||||||    
28481179 caatggggaacccaccaaacc 28481159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University