View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17793_low_112 (Length: 217)

Name: NF17793_low_112
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17793_low_112
NF17793_low_112
[»] chr7 (1 HSPs)
chr7 (1-200)||(37472265-37472461)


Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 37472461 - 37472265
Alignment:
1 aaccgatatgaaaaagaaatcaagaatagaaacgatggaagtgattagtcttacactattaaagggtttccattgttgtgcagataaatggtgtcgggtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| |||||||||||||||||| ||||||    
37472461 aaccgatatgaaaaagaaatcaagaatagaaacgatggaagtgattagtcttac--tattaaagggtttccatttttgtgcagataaatggtgccgggtt 37472364  T
101 gagcccagatgtcgcaca-gtacttgctgaggccaaaaccatatttatgaatggcatctttgatatctaggggaagagaggagccatatttgggtgatca 199  Q
    ||||| |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||  |||||||||||||    
37472363 gagccgagatgtcgcacgtgtacttgctgaggccaaaaccatatttatgaatggcatctttgatatctaggggaagagaggggcc--atttgggtgatca 37472266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University