View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_112 (Length: 217)
Name: NF17793_low_112
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_112 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 37472461 - 37472265
Alignment:
| Q |
1 |
aaccgatatgaaaaagaaatcaagaatagaaacgatggaagtgattagtcttacactattaaagggtttccattgttgtgcagataaatggtgtcgggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
37472461 |
aaccgatatgaaaaagaaatcaagaatagaaacgatggaagtgattagtcttac--tattaaagggtttccatttttgtgcagataaatggtgccgggtt |
37472364 |
T |
|
| Q |
101 |
gagcccagatgtcgcaca-gtacttgctgaggccaaaaccatatttatgaatggcatctttgatatctaggggaagagaggagccatatttgggtgatca |
199 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
37472363 |
gagccgagatgtcgcacgtgtacttgctgaggccaaaaccatatttatgaatggcatctttgatatctaggggaagagaggggcc--atttgggtgatca |
37472266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University