View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17793_low_114 (Length: 217)

Name: NF17793_low_114
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17793_low_114
NF17793_low_114
[»] chr5 (1 HSPs)
chr5 (107-188)||(11051390-11051472)


Alignment Details
Target: chr5 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 107 - 188
Target Start/End: Original strand, 11051390 - 11051472
Alignment:
107 cactgtcatatctttcatcttcttgattccattgttgagagtttatcatgttagccatcgttgcgtttga-aataatatattc 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||    
11051390 cactgtcatatctttcatcttcttgattccattgttgagagtttatcatgttagccatcgttgcgtttgatgataatatattc 11051472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University