View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_118 (Length: 208)
Name: NF17793_low_118
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_118 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 12 - 190
Target Start/End: Complemental strand, 20331755 - 20331576
Alignment:
| Q |
12 |
tcatcacacattttgatgttcataatcatgtttcttttaaaactttggtatcgtgcatttgtaata-tatgttctaaaagaaaactaagaaagnnnnnnn |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20331755 |
tcataacacattttgatgttcataatcatgtttcttttaaaaccttggtatcgtgcatttgtaatattatgttctaaaagaaaactaagaaagttttttt |
20331656 |
T |
 |
| Q |
111 |
nnnnnctctttttgaagaagccaaactagtccactgaattccacgtcgaggagaattgtactctaagactttgatagaag |
190 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20331655 |
tttttctctttttgaagaagccaaactagcccactgaattccacgtcgaggagaattgtactcttagactttgatagaag |
20331576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University