View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_121 (Length: 204)
Name: NF17793_low_121
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_121 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 13 - 184
Target Start/End: Complemental strand, 46062400 - 46062229
Alignment:
| Q |
13 |
gtgagatgaacgattttgtatttttcattaatgcgagatgtggcactaaccgtgatgaacagggtcaacttacttctaaagttagtttaaaatatatgtt |
112 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46062400 |
gtgatatggacgattttgtatttttcattaatgcgagatgtggcactaaccgtgatgaacagggtcaacttacttctaaagttagtttaaaatatatgtt |
46062301 |
T |
|
| Q |
113 |
tagcatcataagagactagaataatatacttgaatcttgatagctgagtgaaccaattattcatgttttagg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46062300 |
tagcatcataagagactagaataatatacttgaatcttgatagctgagtgaaccaattattcatgttttagg |
46062229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University