View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_50 (Length: 356)
Name: NF17793_low_50
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 103 - 341
Target Start/End: Original strand, 12691213 - 12691451
Alignment:
| Q |
103 |
gaaggaattctctactgatcattgtgattttatgtgtgcatgcatgatattgggatcttttttattttcattattattaagtaaaacaagaacagnnnnn |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12691213 |
gaaggaattctctactgatcattgtgattttatgtgtgcatgcatgatattgggatcatttttattttcattattattaagtaaaacaagaacagaaaaa |
12691312 |
T |
 |
| Q |
203 |
nntagaaaaacatccaaataagagatattgtcatattgatatctcgtttcaacataaatgttttgtcattttcctaacaaggctctagtcttcaccaact |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12691313 |
aatagaaaaacatccaaataagagatattgtcatattgatatctcgtttcaacataaatgttttgtcattttcctaacaaggctctagtcttcaccaact |
12691412 |
T |
 |
| Q |
303 |
atacaagttatcaaaaattaaacttttttctttccttgt |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12691413 |
atacaagttatcaaaaattaaacttttttctttccttgt |
12691451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 12691033 - 12691080
Alignment:
| Q |
18 |
atcagatgacaacggtgatgatgtctcacatggctttgacattgtgaa |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12691033 |
atcagatgacaacggtgatgatgtctcacatggctttgacattgtgaa |
12691080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University